PHPackages biotorrents/biophp - PHPackages - PHPackages [Skip to content](#main-content)[PHPackages](/)[Directory](/)[Categories](/categories)[Trending](/trending)[Leaderboard](/leaderboard)[Changelog](/changelog)[Analyze](/analyze)[Collections](/collections)[Log in](/login)[Sign up](/register) 1. [Directory](/) 2. / 3. [Utility & Helpers](/categories/utility) 4. / 5. biotorrents/biophp ActiveLibrary[Utility & Helpers](/categories/utility) biotorrents/biophp ================== BioPHP implements some light tools for manipulating genomic data 03[1 issues](https://github.com/biotorrents/biophp/issues)PHPCI passing Since May 18Pushed 12mo agoCompare [ Source](https://github.com/biotorrents/biophp)[ Packagist](https://packagist.org/packages/biotorrents/biophp)[ RSS](/packages/biotorrents-biophp/feed)WikiDiscussions master Synced 3d ago READMEChangelogDependenciesVersions (1)Used By (0) BioPHP - PHP Bioinformatics class ================================= [](#biophp---php-bioinformatics-class) BioPHP implements a selection of simple tools for manipulating genomic data. It aims to build tools for basic RNA, DNA, and protein manipulation. BioTorrents.de's fork is designed for [biotorrents/gazelle](https://github.com/biotorrents/gazelle)and is heavily inspired by [TimothyStiles/poly](https://github.com/TimothyStiles/poly). Simple Usage (to be revised) ============================ [](#simple-usage-to-be-revised) Find Reverse Complement ----------------------- [](#find-reverse-complement) ``` $BioPHP = new BioPHP(); $result = $BioPHP->reverse('ATGAAAGCATC'); $result = $BioPHP->complement($result); //prints TTTCAT ``` Calculate GC Content -------------------- [](#calculate-gc-content) ``` $BioPHP = new BioPHP(); echo $BioPHP->gcContent('ATGAAAGCATC', 4)."\n"; //prints 36.3636 ``` Count Point Mutations Between Two Sequences ------------------------------------------- [](#count-point-mutations-between-two-sequences) ``` $BioPHP = new BioPHP(); echo $BioPHP->countPointMutations('CTGATGATGGGAGGAAATTTCA','CTGATGATGCGAGGGAATATCG')."\n"; //prints 4 ``` Translate DNA Sequence to Amino Acid Sequence --------------------------------------------- [](#translate-dna-sequence-to-amino-acid-sequence) ``` $BioPHP = new BioPHP(); echo $BioPHP->translateDna('CTGATGATGGGAGGAAATTTCAGA')."\n"; //prints LMMGGNFR ``` Calculate Monoisotopic Mass --------------------------- [](#calculate-monoisotopic-mass) ``` $BioPHP = new BioPHP(); $proteinSequence = $BioPHP->translateDna('CTGATGATGGGAGGAAATTTCAGA')."\n"; echo $BioPHP->calcMonoIsotopicMass($proteinSequence)."\n\n"; //prints 906.42041 ``` Finding a Motif in DNA ---------------------- [](#finding-a-motif-in-dna) ``` $BioPHP = new BioPHP(); echo $BioPHP->findMotifDNA('ATAT', 'GTATATCTATATGGCCATAT')."\n"; //prints 3 9 17 ``` Get Reading Frames ------------------ [](#get-reading-frames) ``` $BioPHP = new BioPHP(); print_r( $BioPHP->getReadingFrames('GTATATCTATATGGCCATAT') ); /* * returns array containing... Array ( [0] => GTATATCTATATGGCCATAT [1] => TATATCTATATGGCCATAT [2] => ATATCTATATGGCCATAT ) */ //Protip: To get all 6 reading frames. Use the reverse and complement methods, then pass the result to getReadingFrames() ``` Find most common likely ancestor -------------------------------- [](#find-most-common-likely-ancestor) ``` $fastaSequence = " >Sequence 1 ATCCAGCT >Sequence 2 GGGCAACT >Sequence 3 ATGGATCT "; $BioPHP = new BioPHP(); $fastaArray = $BioPHP->readFasta($fastaSequence); //read and parse the sequences echo $BioPHP->mostLikelyCommonAncestor($fastaArray)."\n"; //prints ATGCAACT ``` Get a fasta result from Uniprot and calculate isotpoic mass ----------------------------------------------------------- [](#get-a-fasta-result-from-uniprot-and-calculate-isotpoic-mass) ``` $BioPHP = new BioPHP(); $uniprotFasta = $BioPHP->getUniprotFastaByID("B5ZC00"); //returns the result from Uniprot as a string $fastaArray = $BioPHP->readFasta($uniprotFasta); //parses the response echo $BioPHP->calcMonoIsotopicMass($fastaArray[0]['sequence'])."\n"; //prints 55319.0636 ``` Find protein motif using a variable "shorthand" motif search ------------------------------------------------------------ [](#find-protein-motif-using-a-variable-shorthand-motif-search) ``` $BioPHP = new BioPHP(); $results = $BioPHP->findMotifProtein("N{P}[ST]{P}","B5ZC00"); print_r($results); /* * returns array containing... Array ( [0] => 85 [1] => 118 [2] => 142 [3] => 306 [4] => 395 ) */ //Notes: The second parameter expects a protein access ID string used to lookup the full sequence via UniProt. ``` Finding a shared motif ---------------------- [](#finding-a-shared-motif) This task can be very CPU intensive. Using PHP 7, this method benchmarked faster than Python! Runtime results were about 1 second with a collection of 100 DNA strings of length 1 kbp each. ``` $fasta=" >Sequence 1 GATTACA >Sequence 2 TAGACCA >Sequence 3 ATACA"; $BioPHP = new BioPHP(); $fastaArray = $BioPHP->readFasta($fasta); $result = $BioPHP->findLongestSharedMotif($fastaArray); echo $result."\n"; //prints TA ``` Find open reading frames from DNA sequnce ----------------------------------------- [](#find-open-reading-frames-from-dna-sequnce) ``` $Sequence = ">Test DNA Sequence TCCCCGGACTCCAAACGCTCGGTAGCCGCCCCTGCTCGACATATTTAGCTCCCTGCATTG ACGCCCTGGCAGCCCCGATCAATTTTCGTGGTTAAACGCGCGCTCGCAAGGGACATCGAC CGGACCACAGAGCATAGCATGCCTTAGGATCGCCTGTCACTGTTCGTCTCCCTATTTGAG CACTGTAGCCCCTGGTACCCCCGTCCTGAAGCGTGTGTGATACACGGTCTGCCCAAGATG "; $BioPHP = new BioPHP(); $results = $BioPHP->printORFProteins($Sequence); print_r($results); /* * Returns the following array Array ( [0] => MP [1] => MLCGPVDVPCERAFNHEN [2] => MLCSVVRSMSLASARLTTKIDRGCQGVNAGS [3] => MSLASARLTTKIDRGCQGVNAGS ) */ ``` Locating restriction sites between length of 4 and 12 ----------------------------------------------------- [](#locating-restriction-sites-between-length-of-4-and-12) ``` $BioPHP = new BioPHP(); $results = $BioPHP->findRestrictionSites("TCAATGCATGCGGGTCTATATGCAT", 4, 12); //returns an array containing postion and length of restrictions ``` Inferring mRNA from Protein - calculates total different RNA strings from which the protein can be translated ------------------------------------------------------------------------------------------------------------- [](#inferring-mrna-from-protein---calculates-total-different-rna-strings-from-which-the-protein-can-be-translated) ### Note: This method requires the use of the PHP Math Big Integer package which is a composer dependency of this project. [](#note-this-method-requires-the-use-of-the-php-math-big-integer-package-which-is-a-composer-dependency-of-this-project) ``` $BioPHP = new BioPHP(); $result = $BioPHP->inferringMRnaFromProteinCount("MTIFMFHNKNICTEYMGYYDQQIMQTEHKWYWDFHTFMIPNVFYEDVIKFKMRMLMIPNCFFGPWLFCKLEKCQYYEKATEPAPIVKDYTLFATGGAGREATFWPWFWTDENRPKDYYFQRDGLHHRNEPRLPHATCRRAYYQCEMIQYAIVTSCVLLAWKMFTDYGHTGVASEPKEPQEDIKCMKFPHMSWQKTLTEAFYELFPCYPEEFPNDRPWLLGHGFGPIVCTITAIDTTDVAKNIWKAVFRPHAGNWDIGFHSPCASEGCPDIMFPYFTCHDYKGMMCCFNLTMEVCCKQPRPTGIYMMVERMRIMNNREFAGFKHYREEHIKHYWRFGIFASPFVICWSPKTKGPPTSDWYMRDSEVVTQESELKESWQDMMEQHSMFGIPHCEKERWMNDNWKCKLFYYEVILWISNCECDQHVNCCVAHDPGTQVDWAWTLDMWWDQKYFGFFVRKKGQKYNMHWGAPYWLTNPTEKKDFIQHEQLGPLQTFRHCSSPAPT"); echo $result."\n"; //prints 884608 ``` ### Health Score 16 — LowBetter than 5% of packages Maintenance37 Infrequent updates — may be unmaintained Popularity3 Limited adoption so far Community9 Small or concentrated contributor base Maturity14 Early-stage or recently created project Bus Factor1 Top contributor holds 93.8% of commits — single point of failure How is this calculated?**Maintenance (25%)** — Last commit recency, latest release date, and issue-to-star ratio. Uses a 2-year decay window. **Popularity (30%)** — Total and monthly downloads, GitHub stars, and forks. Logarithmic scaling prevents top-heavy scores. **Community (15%)** — Contributors, dependents, forks, watchers, and maintainers. Measures real ecosystem engagement. **Maturity (30%)** — Project age, version count, PHP version support, and release stability. ### Community Maintainers ![](https://www.gravatar.com/avatar/61da7341f1378c05fd43bff67df4490d0a9bd53dc80938ef424f678e764f5464?d=identicon)[pjc09h](/maintainers/pjc09h) --- Top Contributors [![kennypavan](https://avatars.githubusercontent.com/u/1902873?v=4)](https://github.com/kennypavan "kennypavan (61 commits)")[![jeremiahscanlon](https://avatars.githubusercontent.com/u/8504998?v=4)](https://github.com/jeremiahscanlon "jeremiahscanlon (2 commits)")[![pjc09h](https://avatars.githubusercontent.com/u/48838413?v=4)](https://github.com/pjc09h "pjc09h (2 commits)") --- Tags bioinformaticsbioinformatics-scriptscomposerlibrary ### Embed Badge ![Health badge](/badges/biotorrents-biophp/health.svg) ``` [![Health](https://phpackages.com/badges/biotorrents-biophp/health.svg)](https://phpackages.com/packages/biotorrents-biophp) ``` ### Alternatives [rs/laravel-version-control Foundations for making your app version controlled. Provides migration, blueprint and base models. Will make your app GxP compliant if you exclusively use the VC models and table structure as set out in this package. 1227.5k](/packages/rs-laravel-version-control)[mad-web/laravel-seoable Easy to map your eloquent fields to seo properties 407.6k](/packages/mad-web-laravel-seoable) PHPackages © 2026 [Directory](/)[Categories](/categories)[Trending](/trending)[Changelog](/changelog)[Analyze](/analyze)